Description :
Non Conding Region
Location :
Scaffold_1:149453- 149673
Sequence
220 bases(100 bases per row)
GCCTCGTCGACTTGAGTAATAGTTAGTAGATTTAGCAGATGAGTGAAGTAGCAAGCACGGCCAAGGCGATACTGTAGTGCAGACGGCCAAAATAAATTCG
ATGGAATTCGTGATTTTTTAAAATATGCATTTCCTGGTTGGTGTGAGCTGTTCTCATCTACTTCTGCAACAGACCGACACAACTTAAGAGTAGAATTACA
TGTAGCCTAGCACTTCGTTC