Description :
Non Conding Region
Location :
scaffold_1:149437- 150000
Sequence
563 bases(100 bases per row)
GACAACATCTAGCTAGCAATTCAAATTTAGTATTTTTATGTTGAGCAGTAGTTTTGTGTCATGTCACTACTCCTTACCCCAACTAACAGTTTCAGTATCC
TCGTGAAACCACTAATAATGAAAATAATAGCATTTTCTCTAGCCGCCTTTCAAACGAAGGATGTATCTCAGGCAAATGAGATCTTTAGTTCCGCGTTGTG
GTGCATATAATGCTTTTCTGCAATCGAGCAAAACTCAGAAACACCACAGTACTGGTACGATCAGGATGATGAGATCTCGTTACAGAGAGGCTTTTAGGAC
ACGAGGGCTGAAAGCCTCGCGTCATATAGTGCACAAAGAATTCATAATGAGCTTTGTAAACTCATTTGTTTCGAAATAGTTATATTCTAAATATGCGTCA
CTCTTGAAATAGAATTAATAAAAGGTTACATGATCAGCTTTTGTTCTCTATCCTATCCTATCCTATCCTATGCATTACTTAACGCGGATTCAACAGTCAT
CAATTcctgcacggcaaccccgtcgCACTTGGTAATAGTTATCGTGAATCCGACTGCCCAGTG