Description :
Non Conding Region
Location :
contig_1:14918- 16315
Sequence
1397 bases(100 bases per row)
TTTCGAAGTGCCGAGCTTATGGGGAAGGCGTGGGCCGATTCCCACAGGGCCTGCCGATGTTCGTCCTCCAACTGCAAATACTTGGTCGAGATCGTCGTGA
ACCAACCCGTCATCTCGAACGACACTGGCGTCACGACGACGTTCAGATTCTCCCAAGGAGAAATCGCGTACAGGGCCAGGATCTGGAGCTCAGTGATCAG
CCCTTCGGACCACCGATTGGGAGGAGGAGTCTGGTCACTTGGAGGAAATAACCAATTCTTCGGTTTGGCGAAATGATGGAAAAGCAAGTTGACGTCCATC
TCCAGCACGCTGACGCGACCGACGTATCTAGCCGGCCACGGATCGACGTCAACCGCAGTACGGCGAACACGATTTTGATAGCCGGGAATCCACTCGTCGC
GAGGAATGGTGGTTGGCGCAAGCTGTGCCAACTGCCCGGGGTTGAGAAGTTGATTGCGATGAGATCGTGGTCGCTGATCACGCTGTCATCACTGTCAGGC
TGGTTGCCCCCGAAACCCCTTGAACTGCGTCACGATCGGTTGCCGCCCCAGGGGTATGAGCAGTTTGATCACCATCGCCGTCCTGGCTGTTGTTGTCACT
CGACCGATCGCTGCGCTCACTGCTGTCGCCGTGGCTGGATTGATGATCATCGTCACTGCTATCCCGGGACTGTCACCACCACCGGCATCTCCAGAGCGAC
CATGGTTCCCGTTCGAAGCCTCAGAGGAGTCGGGCGACCCGACATCAATTGGGCGATTGGGCGATCCACCAGTGGATGTGTCGGCAGAGCGGCGCCGGAG
GGAAGATCGAGAACCAGTAAGCGCTGCCCTCAGTGAATCGTCATCACTTTTCGATGACGAACCGGACTGAGATCGACCATCCCCGTTTGAATGGGACGGA
CTGTCGCCGCTAACATGCCCCGAGCTGGACCCTGAAGGCGAACGCCCACGGGGCGAATTGGAGCCCAACGAACGCGATCGACGAGGAGGAGGAGGAGGAG
ATGGACTGGCCGAAGATCGTGGACTACGGGGCCTTTTGGAACTGCCTTGAGCGTCGGGCGAGCTCGGCGCTGGTGCCGAAGTGGACCCGGGCTGCACCAG
GGAGATCAATCCAGCCACACGATCACGGATGGTGTCGCGATCATGGCGGTAGACTCGGCCAACAATGTAGGCAGTACCGATAGGCCGATAGACCTTCGCT
TTCATCCATCGTTCCTTGTCCGGCGAGAACGCGACCAGCTTGCTCACGTACACGTCCTGCAGCATGATGGGTGGTGTTCGTGTTGGCGTCGTTGTAGCAC
CCGTTACTCCACTGGTTGTTGCTCGCCCAGACTGTGGTGATTCGGGGATCGCGACTCCATCAGTTGGAATTCGGTCGCCGCGGCTAGCAGCAGCGCT