Description :
Non Conding Region
Location :
Scaffold_1:149020- 149216
Sequence
196 bases(100 bases per row)
ATTGCTCTACCGTCTGATTCTGCCTCATCAAAGACAGATTACCACGAGTATACTGTATACACTGATGTTATCCACGGTACGATATCGAATTTTGATTGGC
GCTGATTCGCTGAAAataagcagcagcaattACTTCGGACACTTGACCATCGCCTGGTGCAGGACGCACGAAGACTTCGAGGACTTGAGGACGTCA