Description :
Non Conding Region
Location :
Scaffold_1:149009- 149192
Sequence
183 bases(100 bases per row)
CCAGCATCCACGGCAGGATCGCGCCGCTTCAACACTCCCACGTAGATTACAAAGCTGCCGGATACTATTTCGTTTATACGGATATATCAAAACGTGATGG
AAAACGGGGCACATTGTGTGCATGTTGCCCGGAAATTTTGCTCCTTGGAGAGCGAAAATGCCCATGGAGAGCGAAAATGCCCA