Description :
Non Conding Region
Location :
Scaffold_1:148951- 149481
Sequence
530 bases(100 bases per row)
CATCTTAGTCTCTTGGGGCGTTCGATCGGTGCCGCCGAGACGCATAGGTGGTAAGCACTTGGACTTCAGTGCAAATATTTTCTGTACATACCAATGAGAA
TGCAGATGTTAACTTCATTTTGTCCAATCAAAGGGTCAAGAAACAGATAAGTTGATTGACCCAAGAGCGCACGCACACAGCAGACAACAAGTTTCGCCCA
CAAGATAGCAAAATGGCTAGAGTGGTTATAAAAGTTAGTAGCATAGTCGATCTATGCGTCGTTTGCGAGGAAACAGCGAAACACGAAATATGAGCTTGCT
CGAACAATTATAGGCACTCACAAAGAGTTCATGCAAATTCAACGGCTCTGTCTCGAGTGGAATTGGCTTGTCTCGAACGCTCGGACATTCATCTGGATTC
ACTCAAAGATAGTCAAATTCAATCACGTCGCATAGTGAGCCCAACAATCACTTGGAACGACCCAATGGAAAACCCAGCCAACGACGACAGCGGCCTCACC
GAGACGCTCCGCAAGCGATCGAGGCCTCCA