Description :
Non Conding Region
Location :
Scaffold_1:148626- 150000
Sequence
1374 bases(100 bases per row)
ttcgttcattattgtcactgccatcaccgttgttcccgtggtcttgccttacgtaggcgtcgccggcccctttcaggccaaaaagtatcctttctgcggt
actgaccgtcctgcgcacgtgcgtggccggcggtgaggccagcacggtcttgccacatggtctgccacgttgcgagcggtgaaaccgcggagccgacgtg
atggccatttcggcgtgctagtgtggaaggaccaggacggcggcggccacgtgaagaagctccacgtgcctctcggcggaaggtggcggatactggagcc
gtcaatgcattgcgcgcggctggctcaggcggagcatccggtacctgcacagtctttggcgtggacgggctggcgttgcacatacgccagctttagagcc
tgctcttgctgcgagcggcagatggcagtgacctcaatctgcgcaaagaagtagcgggaaattgttcgattcgaagcgcaaaaattaggctaactgaaac
cttgcagaaatagtatcactatatgcgttatagcaagtaaatcagaatttgccagcttgtaagaccgcaactctgattgatactcttagcaatttgtgca
gatatatcaggttttgacggcatttgttttgacagagggagcggtggaccacaccgtcattgaatttccaagtgagaaaatgatgcgaaaaatctgggtt
ctcttgatcttgccgaccagcggaagaccgtggtcaccacggtggtgcttgtcttgttgccagcaaagtggttggcaagtgctgcgcgcgtttcgccatt
cgtttcacgaagtgaaacaattcgaacatgaataaagtttggtgaatttttggaaaacggtttccgaatattgttgttttcgtttacatgtacacacttt
gggcccgacgctgcttggggagctacctttgaggccattcgtccaccaagaaacctcacattgcgctcgtgagggttcttggtgcgcggtgtcctccagt
tgttgctcgtcccctctctgcctcaccaagttgcagcagtcaaggcgacgcagactgcacggcgcggagtgcagcggcagggctgcctgcttctcgtccc
caagtttcgccaactccggtgattgcaacttgcagtcgcaaagtgactctttcctggcctgctcgttgagtcaagcacagtcgataaaggaagacggggt
cagcaaccaccggctgggtccgagtctgtccaccctacagtgcagataccggataatgcgtttgactgcaaagcagagaacgccactcacacgatcctcc
gtatcgctatcatggcgctcggatagcggacctgcaagatgcaaagctgtatgtgtacgtgtgcatgtgtgctg