Description :
Non Conding Region
Location :
Scaffold_1:14794- 15212
Sequence
418 bases(100 bases per row)
TCGGAGACCATGACATCGAAGAAACTACATATCCACGTACATGTCAAGCGAGTTGTTGCGCTGTTGCCTTCGCCGGTTGGCGACGTGTGACAACTTGTGT
CTCGAGTATAGAGACAGATCGAGTGTCCAAAAGTCAAACAAGAGATCAATGCGGCGCGATGGAGGCAAGGGCAGAGCAGCATCCAGTTCGCGAAGCGAAA
CCAAGagagacggagacgaagttCGTACGAACAAACAGCCAAGAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCCGAAACGATGACGACC
ACATACACGCGGCTGTTTTTATTTATGCAGGAATGCGAATTGAGACAACCAAACAAGAAAACAAGAAAAATGGTTTAGTAAATAGTCTTCTCGTTATGTG
TTGTAAGACTCGTCCGTT