Description :
Non Conding Region
Location :
Scaffold_1:147584- 147729
Sequence
145 bases(100 bases per row)
GATGGCAGAAGTTTTAAGTAGACTATATGGACGGCTTCCGCTAAGGCAATGGTTGCTGCGACGAAAGACGGCAATCACTACCCCATCGCTTGAATATACC
GTCTTCCTTCTATCGCTGTTCTTCTTGTCCATCGATCAAAGCGAC