Description :
Non Conding Region
Location :
scaffold_1:147541- 147792
Sequence
251 bases(100 bases per row)
GCTCAGGTTCTCGATGAGAAGGGCGGGCCAGGATGGCGAGTGCCACAGTGGGGCCCTCGCCATTGTTCTGCATCAGGTGCTGCGTGCAGAAGTAGGGCGG
TTGTGGTCACGTCGGGAAATCCTCAATAAATCTCAAAAATATTATTGCAGCATTTGAAGCTGCTTACAATAGGTTTGCTCTTCGACGGATACAGACGCAT
GACCACGTAGATACACGTTAACCACGGCATCCGATGATGCCGATCTGGGGT