Description :
Non Conding Region
Location :
Scaffold_1:147403- 147499
Sequence
96 bases(100 bases per row)
GCAATATTATGTCCTTGTCTCCTGCTGGTGGAATCTCGGAAAGTGAAACCCTTCGCGCTCTTTTTCAAATCCGTTCAAAGGCCTCTCAAACATAAT