Description :
Non Conding Region
Location :
Scaffold_1:147383- 148375
Sequence
992 bases(100 bases per row)
TCGTTGGGGCTGCGGCGGCTGCGGGCTTGTAGGTAGATTGGATTGTGTGGGCTTAAGTTCGCAAAACTGGCTAGACGCTGACTGGCAGTTAGCAGTGGGC
TTGTTTTTCAAAAGTATACAAAGCACAAGTGAAAAAAAAACCTAAAATCCAAATTTACTTGAAAAAAACCTTGGAATTTGGATTTACGTGGGCTTATCAT
GCAAAAATGTACCTCACATAATGTGTACACAATTGTGTGTCTCATACTTTTGGAACATCATTTCTAAATTTGTATCGTTCTAAATATTGGGCTCGTTTTG
CCGGTGAGCCGGTAGCATTTCAATATAAACTGAAATTAATCAAGTCACAACTAAGTTACCTTGTTAAGTGAGCTGCATACATGTATTGCGTGGATTAACT
GAGCAAATATCGTCTCTGATAGCTGACATCTTGAGCTACATTGTCATATCTAACTCAGTACCTCGCTGCCACTAGCAATCTGGATGGTGGACTACTACTC
GCCATCTACTCCCTCCTGCTGCGAACGATCGCAATGTGGTAAAAAGTGAGCGTATCAACACTAAATACCAGAGTTCAATGTTACTTCCTCAAACCTCTGG
GCACGTGACGGGCTGCAGTTAGCCCGTTACAATTCCTTTTCCGATTTTGTGATGAAGTTGGGTGTGGCCGACCCACGTCTGGGCCCACAGCGTAGCTCCC
ATCAAGAAATGTTAAAGTTAGTATCTCAAATAGTGGCATGAATACCCAATCTAGCACAATATGGCTAAGATCACAAACTGTGTACTAGCACTGTAAGTTT
GTGTACGGGTACATATACCCTGTAAGTTCTGTTTGATCATGTTTAAGAGGACACCAATGGTTGGCACCGGAGCGAGGCTCCGGTGCCACCCCTGGTGTCC
GAACTTGTTTTAAATTCAACACAACTTCTTTTTCATCTTCCTACTCAAGTCTTCTTCGTCTTCGGCCTCAAGTCTCACCCCGCAACAGGTCA