Description :
Non Conding Region
Location :
Scaffold_1:147330- 147461
Sequence
131 bases(100 bases per row)
AGAGCCAACACCATCGACAACGGATAACAACAAAACCTtatcaacaccaacagcagtagcagaaGCTACTTCTAAACTCGAAAACTAATTAATTGAAAGA
AGTCTCGTTGCAAAATGGTTCGGGTGTGACT