Description :
Non Conding Region
Location :
contig_1:147315- 148445
Sequence
1130 bases(100 bases per row)
GACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTTGTACGCGTCAAGACACTCAGGGTCTCGACGCTTGTCT
CCAACTCCTGTGTCTGTTCGGCAGACACTGCTTGTAGCGTCTAGGTCCCTGATTGGGACCTGCACAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCG
GAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGACCGTGGTAAGATATTCCTTGTATCTGCTGGCGAGTTCTACCCGCGGGCGCACGTGTTCAAGC
CCGGCTTGATCGCGTACCTCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAATCGTCCGCACTGCTTGTAG
CGTCGGCTCACAGAGCCGACGCGTCTTCGTTACCTCGACGCCTAATGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGC
GTCACTCCGGACGCTTCGAGACCTTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCATATTTTCTTCCAACGACTCTCGCAGTCGTTGTTGTT
CCCTCGGGGTGATTCGAGACAGCCGCATTCCGCGCTGTCTTTGATGGAGGGACGCATGCATTACGTGGTGCATGTGCTGCTCCCGAAGTGCATGATCGTG
CGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCCATACCATATCGAACTTCTTCTCTTGATATGAGAAGCGTACACGTACGA
TACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGACTCTG
CAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGATTCGGCTTGTCA
TATTGCTTCTTGCAGTGATATTGACTCTCACTGGGGCAGCGATCTTCAATACAGCGTGTCCAATGTCGACACGCTCGACCGCATCACCAGCAGGACGCCG
GGCGCCCTGCTGGTCCCTCTAGTGTTTTGT