Description :
Non Conding Region
Location :
Scaffold_1:147277- 147547
Sequence
270 bases(100 bases per row)
CGTCGTTCGCGTCGACATGTACTGGCCTGATCTCTTGAACGAGTCGTTTTCAGGAGGAACGGCGCTCCTTAAGGTCATTTGCGGAAAATTGGAACACAAT
ACATCGCGCTTCAAAAACAAACTTCTCTTCATGGCTTGCCTGCGTGCATGTAGCTGTAGGAGATGCGTCGTAGATGATCATTGTGGCAACTTACATCAAG
CTCTGTATTCACGATTCTTTTTCGCCTTTAATTTGGTTATTCTTGCGGCATGAGTCTTCTAACTCTATTT