Description :
Non Conding Region
Location :
Scaffold_1:147071- 147639
Sequence
568 bases(100 bases per row)
TTGGCACAAAGTTGACACGCTGGAACGAACGAACGAACGAGGGGGACAGAGGATAGGGCGTTGGCGCCGGAGCAGACAGACAAACAGAGAGAGAAGAAAG
AGGAAGGTACCTGTGGGGGAGCTGTCAGGTTGGGTTGTGGTGGTGGTGGTGGAGGGGGCAAAGCTTTGGTGCTTGGGTCTTTGGAGCCGCAGGTTTGCTT
GGTGCGGCGTCCGCCCATCCTCCTCCCCTTGGCGTCCGCTTCCCCTACCCGCAACTTATGCTTGCCAAAATGAAGTACTGGATTTATACACCAAGCTGGT
TGGGGTGCGCTGACCCGTTGATCATTTGCGTCTTCTACTTGGTGTTTGTATGGAATCTACACCGTGCAAACCCGTGGGTCGAGTATACAACCCGCTTCAT
GTGGCGAAAACCCGTCCTCTCTAAAAAAAAGTGGAAGGGGATGGGCGGATCCTCTGCTGTTTGGCCATCCGCTCTGGTTCGTATCAATTGTGTGTGGTGC
TATTTATTCACGACACACATTCAGCTAACTTGCTATAAAAAAAAACATGGACGCGAGTTAGATGCAGC