Description :
Non Conding Region
Location :
Scaffold_1:146957- 148049
Sequence
1092 bases(100 bases per row)
TTGAAACTACGGCAAGGGATTGCGAGCGAGAGTACAGGTTGCTTGGGCTCTGTGCTCCCGGGATCGAAATGCGGAATGAGCGGAGTCGGGCCACGTCGGC
TGGTTGAAGGCCAGGAGCCGTTTGAGCAAACGTGCGTACTTGGCCGGTGCAGGCTCCGTCCAGCATcgtgcaccaccagcatcaGTATCTTGCAACGGAC
CAATGGGATCAACGCGGGTCCATCTTTTTGACCAATGGACGACAAGTGGTGTGCAAGTGGTGTGGCCTCAATAAAAATCTCTTGGCGTGCGggccaccac
cgccaagTGACAGACAAACTGTCCGGTGCCTTGCGCTGCATCACGGTGACCGCTGCCACTTCACCACAAGAACGGAGCGCGATCGTTGTCGTGGAGGTGA
GAAGGGCAGCCCGTAAACTATAATTAATGCCGGCTTCAACAGTGACGAGGACAGCAACAGACGCAGCACACTCTGAGCAAGGGTCCATCGGCAAGTTCAA
CACACGAAAGGAACGTTCCTATCCGTGGTGCCATTAGCTCTGCATGGCTGCAACGCGCTCGGCAGGACTCGCACAGTGATCTccaaggcgaaggcgacga
cacCATGCGATTTTTCTTGCCTGCATTGCCGCGAGGTCGTGCACAACGGCGAACCATGATGGTTACCATCGTGTTTGTCGGTGGGCCCAGGGTTGTTGGT
TGTCGGTTGTTCTGCATCAATCCGAATGATTAGATTGCCTAGTGTGTGAGTGAGCTTCACACTGTGAGCCAATCTCTGAGGGTTTATCCCTCGCGCGAGT
GCGGCCGCCCTTTCCTTGAGAGAGGCCTCATCAGATGTTTGCCTTCAACCTGGCCTCGAGGCAAACAACGCGCTAATGCGGTAGCCCGCGCGTCAAAGTG
CTCACCTGGCAGTGtacagcggcagcggcaacgccGACAAGATCGGTGTCGGTGCTCGGGAGCAGgttggcggtgctggagcgaggTATCGGTCTCCACA
ACTCGCGAATGTATCTGTATTATGGTACATGAGATTGAGCGCGGCCCCCCATTGGCTGGTTCTTCGAAAACTGTTACTCCCATGCTGCGCCA