Description :
Non Conding Region
Location :
Scaffold_1:14691- 14779
Sequence
88 bases(100 bases per row)
GCACTTGTTCAATCTGGACGAAATGTCAGGGATGACGACAACGACTCGTACATGTAGTAGTTACTACGTAGTAGTAGTTAGTAGTTAG