Description :
Non Conding Region
Location :
Scaffold_1:146760- 148697
Sequence
1937 bases(100 bases per row)
CTCGTTCTCACGATAAGACGAAACATGGTGACGACGACCAGAGTCCATCTCTTGATCCGTGAGCAACGGCTCATTCTATAACTCTGCATGAGGATCAGCA
CTTTTATTTGCATTTCCGCAACGCGCTTCAATATGCGCGAGATGTGTCCAACGACGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCGCGAGATGTGTCCAACGACGGGCTCACCACCAATCTTCGGGGAGTATCTATCCACTATGTCTTTGCG
AGCTTGTTTTCCCTTCGCAACTGCTTCCTGCGATGAAAGGATCAGTACCAGTGTCACCAGAGTATCTCAATTGTTTACAGTACTTACCTCGGGATGCTGC
TTGATCTGGACCAAAAGGTCAAGAAGATGCTTCACAGACTTGTGTCCTCGAAACGCGCCTTCCGGAATCTACATGGACAACCAAACACATGAGCCAGTAA
CGCATGGTCAAAATGCCTACCTCGACGAGTCCGTCAATATCCAGTGGGTACGAGTTCGGCTGGTCATGTACACTGTTGTGCCACTCTGAAACGTCGCAAT
CACAGGAAGCCCCATCGCCATGGCCTTTACATGTGGTCGGCCCATCCTTCACTAGCGACGGAAGAATGAATGCATTGTTAGCCTTGTACGACGATGGCCA
GGTTTTTTGTGGAATATACTGTGGCAGCACGTGAACGTTTGGCAACTCATTCAATGGCCTGTCTATAGTCACCGATGCAAACTTGTGAATGATGTTCACG
AAGTCTCCAGCTGATGATGACGTTAAGCGATATCCATTCGTATGCAGCACCAAAACGACATCGTCGCTAGCCGAGAACGCCTGGAATTACGCCGCAAGCA
GGATCTTCCATGCCTTTCGTCCTCCCATTTAAAAATCGACAAGTATACCGTCGTCTTGTCCGTCATGTCCATCGTCATCTCACTCGCTAGATTATACACG
TTCCCGACCTGCTCCAGGTCAAAGAAGTCAGCATCCACATCTTCCAGCACCACCTTTGATCGCCTGAATTCACTCCCTCCATCAACAAACACCTTTTCCT
GGAATCTAGTCGGCACCTAGATCTCATCCATCCTGTTCATTCTGTCGGACCTCCATCCGGTACGCGATCCGTCTCGAATATGGTTCATCCGACCTTGAAT
CGGGTTCCTTTGGGCGGACACCGAGATGTCGTGTAGAACGCCGGATCCCATGCTCCCGGCTCCGAGTGGCAAATGGCTAAAGCAATTTTGTTCGGTGTCG
AAGGCGCCAGCAAAAGTCCCTCTCTTCAATCCAATGCTCCTCTAGCTTTGTCTTCATGTTACAAGGCAGGTCCCGAATGAACACCGAATTAAAGAGTCCC
CATGCTGCGCAATCAGCAGCTCAAAAAGCTGCTCAAAAGTCTCTGACATCTCCAGATCGTAAGCAGCTCCTCGTTCCTCTCACTTTCCACTAGAAACATG
ACCAGAATCTGAAGTTACAGCAGCAGGTTCCAACACAGCATCCCCTGCCACGAAGTACGAATGCGCTTCGCTGCAAGAACCCCCACCAGAATCCACNNNN
NNNNNNACACACCGCTAGCAGCGCACATAGAACAAAGAAGAGGTGCGTCATTCCTAGCCACAAAGTTACAATTTTGACAACAACGAGCCGATTTCCCGAG
AAACACCAGTCATTGTCGCATTCACACTTGAAAATGCAGTGGACCGCTAGCTGTCGCTATACGACTGGAGCTGTTCATCGTCTAGTATTTGCTGTCGTCT
TCTTCTTCTTGTCTTGCTTGCGACCACACGACTTCGC