Description :
Non Conding Region
Location :
scaffold_1:146758- 146904
Sequence
146 bases(100 bases per row)
AATCAGCAGTCCATTCCCATGCAGCTTCTTTCTTCAAGAGCTCCGACAGCGGGCGAATCTTGCTCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGC
GAGTCCAAGGAACTGCCGCAGCTCCTTTACGTTTGAAGGCGTAGGT