Description :
Non Conding Region
Location :
Scaffold_1:146407- 147137
Sequence
730 bases(100 bases per row)
GTGAGGAATTGTCAAGTTTGACTTTTGGATCGGCAATATTCTCGGTATGATTTATGATAGTTCGGTTGGAATGTCACGATATGCTATCGACCGCCGAAGT
GCCCGAGACTTGAGCGCCATCGCGTAAGAACAGAGGTGATGAGTGTTCCGAAGGCTCGACGACGTTACGCCCTGATGTCTTGTCAGAAGTTGTGTGGAGA
AACAAACACGGTGACCGCCAGGCCCTGCACTGCAGGCAACGCTGAGCAGCCCATGTCGGGCTTTGAGTCACGTTGACCAAGGCGGGACCAGTTTACGGCA
CGCGCTTCGATTTGTCAATGTTCACTCATCTGTGCAAGTGGCACTTGCCAAGTGCACGTGTACTCGGAGTTGGCGTGAATTTATCACCACCATCCTCCTG
GTGCAGGCATTCTCAGCCAGTTCTACAGCTATCGCACAAAACTTGGTGCACACACGAAGGGGCCCAGCCGCTAGCAGCAATTGCAGCTAAACTGTGTCTG
CTTCGTTGACCGAAATCGCTTTCGGGAGGATGGATCGAAAACAGCGATCTTCCTGCAGGCTGCTTCAGGTTGAAGCGCGACGGTTTCAGGCTGAAGTTCA
ACTTTTGGCCCTAGCCCTCGTTTACGTGTCACTCGTGACATAATGAATCCCGCATGTGCGAGTTCAGCAGCCTTATCTGACGATCGCACCTCCGACTTGA
AACGCAACGGCCTTCCTCCTCGCGGGCAGG