Description :
Non Conding Region
Location :
Scaffold_1:146094- 146348
Sequence
254 bases(100 bases per row)
TTGCAAAGGTTCTTGGAGCTCGTCGAGATTGCCAATGACCGTTATGCCCACGAAAGGGTGCGTCTTTTCAACTTCAAACTGCTTCACCACCGGTATTTTA
TCCAAAAAGCTTTATCTCAGGTTATCCTGTCGTTTAGACTATCGGTTCATCTTAGTAATCTACCGGTTCATCTTACCGTTCTATTTCCGTCATCATGGTC
GTCACTCTTCAATTGACCAGCCAGTCCACAAGTCCAGCGTCTGCCCACTCATCA