Description :
Non Conding Region
Location :
Scaffold_1:146042- 146691
Sequence
649 bases(100 bases per row)
TGCTGACTTGCAACTTGTGGTAACGTAAGGTCAGGCAATGAGATTGGACAGACAGGTTCGCCTTCAACCACGTGGTTTACTGTTGACTGGTGGGCCTTCA
ACCGTGTCAAATTTGACATCAGCTTCCCAGGATTGTTCACTTTGCAGAGGACATGAGTATGTTTTGCACAACATGGCGATGTACCCGTCACGGGGCCATT
CCCAGGAACGCCCCCCGGGTGTGTGCTTTCCAAATTCGTCTCTAACTTGATACTGGTCGATGATGTCGTCCCTTGGTGCGATACCCTCGCATTTTGTCGA
CTTGCAATTGTGGTATCACTGGCTTTACCCTGAATCATCATGTGCAGTCAGTTATAAACCGTCAGGAAGTTGAAGTACATACATTAGTTTGAACTTGATC
CCAACGTTTCTTCGAACGTGGCTGAATCATGGTTGCCAACTTGTAATTCACTTTGACCTCAGTCGACTCGTCTTGGGGCATTGTAGGCGTGCGAGTATTA
CTCCATTCTCTGGCCTTGGGAGCAACAACTATGGCGTCATTCATGATTAAATCGGATATTTCGTACGTACTTGTGCCAACGTCGGAATTAATTCTGAGCT
CTGTTCCTCAAAGGGTGGATCACTTATCGTAAGGATTTCAGCTGCCACC