Description :
Non Conding Region
Location :
Scaffold_1:146021- 146849
Sequence
828 bases(100 bases per row)
TCGTTATACAAGTGCAAAAGTGTGGACGCCCACTGGCTCAACTACCGAATCCCGTTTGCAGGTTGTCTTGCGATGGTCCTCCAGCCGACGCAAACTCCTG
GCGCAGTATCAGCAGCGGCACCTAGGTCGTAAAAACATTGCCCGCGATTTATGTTTCTCCTCAGTTGAAACAAATTCTTGCCGTTGACAGCCCCGTGCGT
TGACATGCAGTCTCTCTTAAGCTAGAAAATGCGCCCCAAAAATATCAAGCCAATTTAAGAAGATCGCAAACGTCGTTTCGATTTGCGATCGACAAGTCTC
ACGCCTGCCACCGCTCGCTCCACAAGAGCCCTTGTCTCCTTGGCTCACATCATTGACGAGGAATGCAGCTGGTGGTCTTGCCGCCGAGTGCAGCCACGAC
ACGATCCTTAGAATGACATGGACGACTGCATGGACGATCACAAGCTTCAAGCCAGGACTGCCAGCTCTGTCCTTGTTTTCTCGAACGCGTATCGGGCGCC
TGATCGGTCGCTTCCCATCTCTGGCCACATTGCACGCGGTTGCGTCATATGGTGATCATGCCTGCGATGAACAAACAATTCGTCCGCATATATGTCCATC
CTCCGGATAAAAATACGCTTTCATGGTACTCGGACCGTGGAATTCGCTTGCATGAGTACATAGATGCTTGGAATTCGCTTGCACGAGTACAAAGATACTG
GGTCGGATGGCAATGTGGATGCGGGAAACAATCCACTGCACGATCCCGCAGTCGATCCGGTCGGCAGCAGCTTCGTGTGGCCACCACTTTACAACTGCCC
GGACGCCGCCCACGTCCAGTACTTAGTA