Description :
Non Conding Region
Location :
Scaffold_1:146012- 146227
Sequence
215 bases(100 bases per row)
TGGAACGGCCTTTAAGTACGTATTCGGTGACAAAAAAGGGCGCAAAAGCGCCAAAACTGTGCGCTTGGAACCCGAAGAAAAAGATTGAATGTTTTTCGCG
GGTTTGTGGTCGTGTTCTTTGATTTTTATCCAATCCTATTGCGGAATGGATGGGGTCTTACGGATGCTGATTGGTTGAAATAAGATTTTCCTATATTATC
CAATCAGATCGGTCT