Description :
Non Conding Region
Location :
contig_1:145923- 146026
Sequence
103 bases(100 bases per row)
GAACGCCCCAGCGACATTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGATTTCGGACCGAGCTATTTCGATGATGTGTTCATTCACAGCCAC
GGT