Description :
Non Conding Region
Location :
Scaffold_1:14562- 16502
Sequence
1940 bases(100 bases per row)
TTGCTCAATGACAAGTGTCAATGATATCTGTTCAATTATGCAATCATACGTTTACATTTAGAATTTGTATAGGCTGAGGTGTACGATTTAATGTGTCGCG
GTGGCAAAAACAAAATTTGAATGTGAAACCCCTACACTTTGCGAATTCGCGATTGCTGTCAAATATTGGTTATTTCTACTAAGGAGCTATATTACATAAC
GAAATAGCATCCGCAAATTCGCAAAATTGACTGAGCAGTAGACAAAAACATGGGTTTACGATATTACTTGTCGCGGAGTGTAGTATAGCGCTGTCTCGTC
ACTATTGTATACGTCTTTCACTTCTTAGTCGACAATGCGTGCGCGCAGCGCTGCGCACCCTTTTGACTGAGGCAGCACTAGCTGATTCGGCTTGTCCTTG
CGTACGTCGTGAATTGAGGTTGTGACGACGTTGGAAGTTGTATGGACGAACTGGAAATGGTTTAAACATCATTCTCGCTGTTGGAATTTGGGTGATGAAG
AAAGTGAGTCGAATTGTGATTATTTATTACGTCACTTTATACTGACAGGAGTGAAAATAGAAGGGACACCAATATTTTGTGATCGTGGTCGTGGTATGAG
ATAAGCTCACGACGTAATCTTCTATACAGTAACGGAATCATTTGTAGGATTGAATGCAGCATTGAACAACATGAATGACGCTGTTGTTCAACATTATCCT
TGTCACGTTAATGGAAACATAAAGCTCAAATTTCGACAGAATATTTTTCAGGCTGTAGAAGTGCAGATATATGACCTTCAAAGTTTGAAGACCGAGAAAG
AATTTAATAATAAGATGAAAGAAATCTGACTCGACATGGAGTCGAGGGGGCAGAAAGAGGAAGTAATACGTCAAATCTTTCAGTACGTAATGGATACGGA
ACCTGAAAAGTGAGCTTTGTATGCAAGCATTGGGGTAACAAAATTGTATGGATAAAGTAGTACTAATTTTATTAAGTCAGAAAATGTTGCAGCCATAGCT
ATGCGGTAATTGTATGCTTACGATTTGTTTCGCAGTGTTATGGAAAGCTTATGGAGCAAGGTTTTCAAACCCTAAAACTAACTGAAAATTGGAAAACGAA
GGTAGAATAGTCACACCATTTTCTGAAGAACAATTCCGAGAAATGAAGTACAAGGCTGCTTTCTTGGATTTCAAACCAAGTAACAACTCTATAGCTTTTG
TACAAGACTCTCATATCGTTCCCAAGCAAACTCTATACCGACGCATGATCATTGAAAAGAAATGCTACTCGTGTATGTATATGGACCAGATTTTGTACCA
TGTAAACACTTTATAGATGGCTTGAGATGTTTTGGACGTGATGAAAAAGTCTATTCAGCATTTGATTTTTCTTAAGTCAGCGGTGTAACAAAGCACACTG
TGCTCGGTCATCTTTACCTAATGTGACCAGAAAAGTCAATTGCTGTTTTCATCATGCTCACTTTATGATCCAACAAAATTGATACAAAAACAGCAAAACT
TTATAATCGCGACTGACACAGCTGTAGCTGCTACACCAGCACTCTCTCCATCTTGCTCGTCTTGTGCTCTCTGCTCTCTTTACATCAGGAGCTCTTTCGT
AAGCAACCGCCCTACTACGTCGACAGTCTTTCTATACAGCCATGTCCTCTGCCTCCTCGGTGGCAGCAAAAGCATCTGAGTGCGCTCCTCTAGGATTCGG
AGTCACAACTCCAGCCCAAGTCTACCACCACGCTTCGTGCTACCCGTGAACTTGCCCAGTCGGCGCACCATCATGTCAATGAACGGCTGAAACAGCCCCG
TCACCGCAAATACGTGCTTGAAGTTACTCTGCTTCCCGGTCACGTGCTCAACGAAGGCCTTGCTCGCAATCCGCACTGCGCTTTACTTTGACAGCGTGGT
CGCCGAGCTCTGCGGCCTATTTTTGCGATCTCGTTCGTAA