Description :
Non Conding Region
Location :
Scaffold_1:145494- 147372
Sequence
1878 bases(100 bases per row)
aTtGGCGTTGGTGCTGGGgAAGgAaTGGCGTCCGGAGACGATGCTGGCGTCGGCATGGGGGTCTGTACGgTTCTCAATCCCGGCGTCTCCCCCTGTACGG
GGACTGGTGTGCTGACGATGGACGATGGCGATGGCGTAGGAACCACAGCACTGTCGATGACAATGGCTGTATCATTGGCGGTGAAACACTCGTCAGCCTG
ACCGATGGACGTCGCAGCCAGGCCGATGATCGTCGCGAGGAGGTACTTGACGTGCATGTTGCTTAATTGTGGCTGTTGAGTCCGAGTAAAGTTGGAGAGT
GAGAGATTGCCTGGGATTCGCAGAGCAGACAAGATCCGCTCATGGCACGGGAAGTCGGATGACAGGAGCTGCTGACACAGACACACTCATAGTTCCCGTG
AGGTGCGTCGAAGTCGAGTCGAACGTTCCCCATGATGACGCTGAACGAGGCTGCTGTATGTTGCCACGAGCAACACCGTCGGACCCACCTTCAATCTcGT
CCCCTGCGATGCGTGGGCCAGCAAGGAGCATCGCAGGCTGCTTTAATTATCGTCTTGCGAGATCGTTCACCTGTCTTCATGGGACGTGGCAGCTCGGTGA
GGAGCCGGGAGGTTCCAGTGGGCAGGCTCCAACAGCCGTTGCCTCACACGCTATTTGGAGACGCGGCTGACGTGACCAGTGCGGTCTTGAGTGTGCATCG
TGTTGCAGGAACGAGCGACGATTGTGTATGCATGTAGCCATGGGCAGGTCTGGGAACTTGGAAGTATTCGAGTTTTGTCGTGCCAACGCCAGCGGGTGAC
CATAATGCGAGCGTGTATCAACACGACCGTCCTCGGTTGATTGGTGCTGGAGGTGATGTGCCAACGCTCGCTTTGGTCATCGAgaggggggggggggggg
gCAATACTTCAGATACCAGTCACCTATGGATATGGGGTCATTGGCGTGTTCCTCGCCTTGCCATTTCACAATGCGAGTCATTGAGGATTGTTCAACTCAa
TAGCGAGGACAGTATACTCGGAAGCTGTCGATCCCTtCAAGTGGTTtATCGACTGGAGGCTCCGACGCAAGTTAACGCACATGTCAGAAAGAGCGAATCG
AGGTGAACCCCCTCTAGCTTCGTGCAGCAAAGATGCTCGGAGCAATCCCAACGAACTTCGTGTTGATAGAAGCGCAGTAGATCACATGCAACATTGTTAG
GTGGAACAAAAGaTCGAACATTTCGAAGTTGAGGCCATACTAAGGCTATGTGAAAGTACCAAAGAACGTGGCAAAAGGCACGATGGGCATGAACTTGGAA
CGTTTCCTTCAAGCCACAGGTTGAGTTTTTCGTAAGTCGAGATCGTCAAAGAAGGAATTGAAGTAGTTGACTTCGCCGAGTATTACGCAGAAGTGACGTC
GGTGAATGCGCCCAGCACGTTTGAAAACAATGGCCGTGGGCCACGGCGTGGCACTGTGGTTTACCATATTTGTCGCGCATGCAATCGGAAAGTaCGATTT
CAGCAGGTGATGTGGCTTCAGTGGGAGAACCATGACGATAACGTCGATAGACAGGGTGAATCTAATCGAAgagTtCTTTGCTGCTCACTGGTGTTGAAAG
TCTACAAGAACAGAGCGTATCCAGCAGGTCAGACAGATTATCTGTGATACTTAAAGCTGTTCGTGTATAGCGGTTAAACTGTGCGTGTTGCCAACACCTT
CAATAGAAGAAAGGTCTCCGTTCAAAGTTCTCGTGGTTACTCTAGGGTCTCGCAGGGATTCTAAATCCGTCAGACAGAGGCCATTTGAGCTTGACCATTC
CGTGTCTGCCATAGTTTCGTGATGCCACATGCTGGGACCAAGATCATTTCCCGATCGATCGCATCTACAAGCTTGAAA