Description :
Non Conding Region
Location :
scaffold_1:145423- 145773
Sequence
350 bases(100 bases per row)
GTTTTAGCGGTGATTGGTTGCGTTTATTTAGCTCCAAGCGTGCCAAGTTTTTGGTACCAATCTAATAGACAATACAGTACTGGCGGTGTCATCTTCTCAT
TGAGCGCACTCGCGGCTGTCAAGGCAATTCCTATAATTATTACACGAACGCCTTCAGCCCTTGACAATATGGATAGAGCGGGTTTGCTATGAAGTAAGAA
GAGCAGGCAACTTTATTTACATGTATTAGCGACCTCAATTTATGACCTTAATTACGTTACAAACACTTCAACTTTGTACAATTATGAGCGCTTTATTCGG
CGCATTCAATAGACTATGATGTCTTTCCAAAAAAGACAAGGGGCCTTTGT