Description :
Non Conding Region
Location :
Scaffold_1:145110- 147386
Sequence
2276 bases(100 bases per row)
tccttcccttcaaggaccgcggggaaggcgccttctggcagaagttctgctgagtgatcgaaccaagactcctggagtcacctgttgccgcatttctgat
tcctgtctctatgcaagttgccgttcgcctagcgaaatggtttagcaaaatcggcaagtcaaatttttcaggaccaccggtctcgacatcaatgtcgaaa
gataaaggccaaagaatccatttctccgagcgaatgcaccatgagaagaagaacatttttttttacttcctcgttgcagttaagctgctcgtcacgtaga
ctacgtcgacgacagcagtgacgtaagaggatagatcgcgccgcttgacccgttgcacttgaagcttcagcaagctagcggccccggacgctgcgtggtc
cacattggcacaaaaaacaatcccggctcgtttttttgcactttcataatggcgggaatggcgaatgcggcgagagactgccgtggaggtcgagcgagtt
gcggtcggcggcgccgccttcatcttgatgatcggagccactggccgatcaggtcgttcggcccgatttaaaatcggagatttgccgagggccgcggcgg
aaacttgcttgggccgagcctacactcgcacgccatcgggcagtgtctgcctttcgatatggcctgctctatcgctatgtttgactcagttgaccgcagc
tgccgggtggccagctccgccgccattagcctaataataatgcttaggatcgaagtcaagtcggtttgccgtggcgtcacggggcattcgcccgggataa
agacgcgcgataggggcaagccgcggcggctctgtccatgaccaagtggtccctccactgtcgccggcaaagccgccgtgcggccggccggggcggcgga
gcactcggagccaagcgagcctgcattgccgaggccgacctagcgcgagtgccgtcggaagcacgcgcgaacgtgcgtggagcggggcgtttacgcttca
accgcggcctgatattccaactcaggcgggcagtgcccgccgtggcaaggctgcaagttacgcgtgtaacttgcggccgccatggccaattgcagtaggc
tgcgaggagctcgcgcgtgatgaccctatattgctgctggcgctaagcttcgatggcgccgtcctcgcgccttagcgcctagatctcgcctgaacccacg
cctgttttggcaatcgcacgccataactcgctaagatatcggggcagacgagcaccgcggcagctggacgttgattgaccgtcgtcagcgtcccacgtag
gaatggcaacaatggcaagggcaacatggctccgcttttgtctgggggcttgcttgagttaagccctaagcttaacggtcaagctgcagccccaccgcaa
cgcgtgaggcgttgaacttcggacaagagggtttcgaggaggccagccgcggcgagctcataccccacgtctggtgaggagaggtggctgctgccgggca
accgctcgaagcatagtgaccacggcaacttggaagccaaggtgccccactgcgacgcaaaggccggaatataaggcagagagccgagtgcagttggcga
ggagatcgaagaaaagcctgtgacggagcgcgccctgctttgcgagcactgttactgtaagtaagtcgatcgtttcgggcagctcgttgcaacttgcagc
tctaaaactccagccccctccgccaaggacatgcacacgggtagcgccatcaagcaagcctgatgccggtttgggcgtttctagcggaaaaaggcgcagg
ggtgcccttttttcagcttatcgtgacatttggacttcaaaattcaccctagcagaagcattaccagcgccaacagcatgcagcgtggcagccgcgcggt
cggtcgggtgactattcactgctgttactcactgtgcgcactgcgccttggtcatctcgaacggacactggggcgaaatattgatctggaatctaggctg
gatatcgaggcgaaggaaagcattcttaggaatcctgagcggcactttgtgccaggtttctgcaaaaatacaattctgcttgacttgacgtgagtatggg
tcgaaattcagccaatcagccaattgacgtgcctgcccatccttcttgttgtgatatttgcctattcgaccgacgcatcccgcccgaatttggaagggaa
caaattggcgtggcacactccacgacacagcctccgcgcgcaccagcccagcgccgggccagtaccattcgccatc