Description :
Non Conding Region
Location :
Scaffold_1:145003- 148073
Sequence
3070 bases(100 bases per row)
ATGCTGATGCTGGTGATGTTAGCGGGTTCTTGGCTGGACGCGGCGCTTGGCTCGAGTTTCCGCCAATCAGCTTTGTTTTACACAATGTATTGAGAGGAAT
GATTTCGATGCAGTAGTGCCGAGCAACAGAATACCAGAGTCCGTTCCAGAGGTTTCGTTATCTTTGTTTTCGACCAATGACGCGCTGGCTTCAACGATGT
GAAAGATTGCAACAGGATTGGTCGAAACTCGACTGAACAAACCAGCGCTGAACACCCACTTTGCCCACTTGAACTCACACCCGCTCGATCGAACGCTGCT
TCTATGCAGAGCTCACGGACAAGCACGAGTCGGCAGCTCGCCGGTGCGGAGGGAGGGAGGGAGGAATCTGAAAGACTGCACGAAGCCAGCCGGGAGAGTC
TGACTCTGCGAAAAGTAGTCAGCAGGAGAGCAGGTGCGCGCTGGCCCATCGGCCGGCCGCGCTCCTGGTCCGGCGCATTGATTGGCGGAGCGGCCGCGCG
GACTCACTCGGAAGTGAATCCATGTTTGGCTGACAGAAAGACAGGCCCACTGACATGTGGCGCGGTTCAACTGTGGGCCAGATGCCTCCAAGTCTGGGTT
GCAACTCGGGCACTGTGTAAGGGAGGAGAGCCTGTACCGTCCGTGTTGCATGGATAAACAAGGGTCCCCATCCCTTCTCCTTCTTTCTTCCAGTCTTGGT
GCATCATCTTGTTCAGCCCCCCCAGTTTTTCTCTGGACTCCTTAGCCAGTGCGGCCCATACAATCGACAAGTGAAACGACTCCACGTCCCATGGCGAGAT
GCCGTTGCGTTCCGTACTCTGAACTGAATACACTGAGCAAGTGTGAGTTTGGTTGATAAACACTCTGCCTGCTCTGCGGATACCACGCGCAATACCTTAG
CAAACGCACACTTAGCACACGCTCGCTGCGGTCTCTCGTTTAGCAACCGAGTGCGCACGCCGTACGGTACCGGTAAATGGAATGTTTCTGGTTTGGGTGG
CGTGCGGGTCTCAGTTAGAAAACTGCTCCCCTCGATGCGACGCCTGTTTGTTTAGCAAGAGGCCGGTAACTGGCTGCCTGTACCGTACGCTGCGAGAAGT
GGTGCGAGGCGCTTGGTCGCTCGGTCGAGAAGCGATTCCTAAACGGCGGCGCGTCCTGGCTGGAGGGTTGAGGGCGTGTCGACTGGGCGGGCGGTGGCAT
CAGCTCGGTCCGTTTTGTGACAAGGCGGGAGGCGGCGGCGCCACTATGGACGACGAGCGAATCGGGCGGTTGCTCTCCGCCCATTCGACTGAGCAGACAC
TCTCGCGCTTTGACTTGAAGAAAGGGTGGGCCGCGCCAACTGCCGCCATCTCCCCCACCCCAGCTGCCACCACCTAACCCTACGACACTCACTCTCTCGC
TCGCTCGCCCGGGTCTTTGTTTTCCGATCCAAAGTTTAGCAAGGCGGGGCCAAAGGGTGGTGGGTGGGCGACCGGACGGAGCGAGGATTTCAGTTCAAAA
TTCTTCGAGACGGACGGGGAAGTCGGACTCGTTAGCCAGGGCGGCGGCCAGGAAGATCCGCTCCTCACTTGCTAACCACGCGGATAGCAACCCGCCAGTT
TCGAGTCGCGTAGTGAACTCAGCCTCCCGTTGCTAACCGGCCCCCCCCTTTCCTCGACTCGACTCTCCTTCGGTCTCCGCATGACGTCCGCGCCGCCGAC
CGCGCCGCCGCCGGCGCCTAATGGTGCCATGGCCGCACGCAGCCAGGAGCGGCCGGCCAAGAAGCGCAAGACGGTCGCGGCCCCCGCGCCGGCCACCGTG
CCGTGCTCGCTGTGCGACTTTGCGGCGTCGACGCTCGACCATTTGCTAACGCACGTGCGCGAGAGCCACCAGCGTACGACCACAACCGTGCACCTGGGTA
CGTTTAGCACACCTTGCTAACCCCACGTCCGGTCATGTTGAAGCCACTTTTGCTAACCTCACCCACGTGTTTGTTAAAAAATCCCCAGCGCTCGCGCTCG
ACGTGGGCCAGATGCTGATCCAGTACGCGCTCTCGAGCGGCGCGCTTGCGGGCGCCACGAGCGACTGGCTCGACGAGCTGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCGGCGCGAGTACGCGTCGGCCGCGGAGCTGCGCACGGCGTTGACCGCGCAGGACGAGCGCGCGGCCGCCGCGCAGCTC
CGGCGGCTGCTGCTGCCGTCCGGCCCGGTTAGCAACCCGGCGGCGGCGATTGGCTCGTCGCGCGCTTTGCTATCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGGCGTTGCTAAACGACCTCGAAGTTGCTAACTCGGCCGCGATCCCCGTCTCAGCCGTATCCGCGGG
CGAGGACCAATCACAGGCGCAGGACGCTCACGAGTCGGCCGCGGCCGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCC
ATCCGCATCCCGCGCCGTCCCCGTGCGGCCGACGTCCCCCCCCGTGGCCGCATTCGGCGGGCTCGCATCCCCGCTGTCCATTACAGCGCCGCCCCCGCCG
CCGTTCGGTCCATCCGCGCTCTTCCCGCCGTTCACGCCGTCCCCGGCCACGCCTTCATCGCTCCCGAGCCTATTCGCGCGGCGGGTGCTCGCCCCGCTGC
CGTCCCCGGTTCCGTCCGCGGTTCCGGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCCCGTCCGCGGTTCCGGTCGTGGCCC
CCGAACTATCCCCGACGTCACTCACTCCCGTGTTCTACCGGCCGTTCGCGGGGGCCGCAGGGGCCCCGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCCCTGCGGACGGCAGCAAGCAGTCCCCCGTCCACCAGAAGCGCAAGAGCCTCCCGACCAAGCAACTCGCTGTCTCCGTCCCCCCGT
CCGTCCCCACGTCCGCGGGGGATCCCCCAAGGACGCCAACAACCCCCGCGGCCGCCTTCGCGCTTCCTAA