Description :
Non Conding Region
Location :
Scaffold_1:144950- 145226
Sequence
276 bases(100 bases per row)
ACAGGTATCACACGAGTAAAACAAGTATCTCATGTGCTAAGCTTACCGGTAGAGCAAAGCAACAGGTTGGTCGAGACATTCGCGACGCTGACCGCTATAT
TTTTGCTGTTCATTCTGCTGGTGCAGTACCGATTAGATAATACTTACGCGCGGCACTCACCACCACAGTTGGGATCCGTTTCGCTCGGTATCGTGTGTCG
ACGACAATTCCTCGCTGAGATCCACAATTGCTTGAGGCGAGGTCCTTGATACTGGGATGTTGTATTCTCGAAATCT