Description :
Non Conding Region
Location :
Scaffold_1:14487- 14600
Sequence
113 bases(100 bases per row)
AAACCAATACCGTCCACCAGTAATAAATGTGGGGAATGCTGTGCAACAACCGTCCACCAGTGTCCCCCGTCTTCTTCAACATCAACACAACACCGAATCG
GTACACTGTACCA