Description :
Non Conding Region
Location :
Scaffold_1:144790- 147451
Sequence
2661 bases(100 bases per row)
CCTCCTTACAGCTTGAGATTCGAAGTCAAACGTGCTCGCAATATTCATGGCAGGTGTCGGTGATAGTGTTGGTCGAAAGCTGTGCGGGTGGGCAGCAAGC
CGTACGGTCCCAGCCACCGGATACTTCATATTCAAGCTTGGATGTGGCCCCTTTGGTAGGTGAATCTCATAATAAACTATCTAAGACAGACTGTCGCTGC
CAAGGAACTATCGGTTGCACTCGGAAGCTTCACTCACCAAGGTCGCGTCACGATATGCTATCTCTGATGTTTTGTTTGGTTGCCACGAAAAACGAGGTTG
CTGCGAAACTCTACAAGGATATGCAGAACTTCTCGTGGGGTGGGCATCCAGTCAGAATCTTGAACGAAAAGGTGATTCCGTTTCAAAACACTAGCAAAGC
ACTGCCCTTGATTTACGAGCTCCATACCAACGTATCGACTAGTACTGCAACGCTTGTCCACTCAAGTCGAGGCGTAACTCGTGACCGTCATTGCTACTTC
TTGCACCACCCACCGCTTCCTATGCAGAGCAGTCAGCAGCGCTTAACGATACTTCAGTGGGTAGAGAGGTTAACACGTTGCACTCGGAGAGGAATCGGCT
CGATTTTGATTTTGATCTGACTGGACTCCAGGCACTGGAGGACTTGTCAAGTTGCAGCTACTGTCTGCAGTGATTGCGAGCCTGGCAGTCTACAGCTTGC
ACGCAAGTTGCATTCACGACGTGGTGGTGCCTTCTGAGTCAGAAGTTCTGACGCGCCGGCAGCAGCCTGCACCCGACCCCAGAGGATGAGCCTCATCAGC
ATGAGCTACGTATGATGAGGTCTGAAGTCCAGACTCTGGACCTCAGCGAGATACAGTACTGTATGTAGACGGACTACTGTAAACGCTGCTGTACTTGTAC
ACTGTCGTCTTGAGCGGCGGGATCCGCTCTGCAATTTATTGCGATTGCCAGAAGTTGTTTATTTTAAATTTGGGTTGCAACAGCGCTGAAGGTCGAGCAA
CCCCCCTCGGCATTAGACCGCTGTTGGCTTGTTAAGCCTAGCTTTCATGCACAGTACTTGTACTTGTAGACAAATCAAGTCGCATGTTAAACGCGGCGGC
AAGCGCGTCGAAATTAGCGGAATTTCTCGAAGCACAGATTCTGCTACCGAAAGCAAAGCCTGTAAGTCAGTTCGTAATTCGACACAGCTACAGTGCACGT
ACCGGATAAATACATGTACATGCAGCCCGGAGTAAAGCCTATCTAGCGGATGCAGCAATGGTGCTGCAAGCCAGATAGCTCTTGGGTGCATCGCATAGAT
TTCATGGCAAGCCAAAACAACGGTAAGCTTACCGGTACGTATCAAAACGTTGCATTCCAAACGTGCGATCGACACCGGTACGATGCTGCTTCCCATCTGG
TGGTCGAGCTTCAGCGGACCCCGTACGAATCGATAATTCCCTCCACTGACGTTCGCCCGCATGCCACCTCGTTGAGTGGGCAAGGCTGCCGGTGTCACTG
CTTGCTGAGCAACATCCTGCACCGAATACTCGTCAACAATGTTCAGTACACCAACTCCGATTTGGAGTCCGACGGATCCAGCCCAGTCGGTCCATGGGGT
CATGTCCAGTGTAGAGTAGCAGGAAAGTCTTCGACTGCAGCAAGCAAAGCGTCACTACACCGTACTGTACCAGACCCTGCCGTGGAGCAGTCTGCTGCAA
GCAAACGTGCTCAACACGCATGCGTCTTACCGGACCCATCTCCGGCGCTTGGTGTCAACAACCGCACTCAGAGGCGCTCATCAACTTGTTGAGTCCGCGG
ACCAGGTCCAGTCTCGGCAACGCTAAGGAGTCGTTGAACGACGGGCACGCGCGACTGCCGACTGCCCCATCTCGGTGCAGCGGATCGTCTCTAGCTGCTA
AATGAATGCCGTGCTCCCAGGCAAAACGCGGTCTTCTAAGCCACTTGCTCAACCGAAGCAGGGAGGGCTCCCAGCCGTCCCCCACTTTCGCGCTGCATTT
CTGCCTTGCATTGACGAATTCCCTCCTTCATTCGTTCGCTGCAGATTTGCTGCGCCTTTGAGCTCCGATTCCTGCATGTCCAAGTGTAATGTAACGTTGC
CTCCTTCTCGTGAGCTCCAGACTTTCACAGAGCAAAAAGGAAGTGTGCTGGGGGAGATGGTGTCGAAATAGTCGCAAAAAGACTGTCCATACAAACTTCA
AGTATAACGTCTGACTCGTCTTGTCTTCCTGTTTGTATTTCGACCGTTCAGACATTCTCTCCGCCAATCAAATAGCCGATACCGTGCCGAAATGTCCACT
TCAGTACTCGTCGCCGAATCGGAGATGGACAATGTCCCCCGAAAAGGCCGGTACCCTCATCAATTGCACCAGGAGCTCACTTCGGACGCCCCCGCTCTGC
CCTCGCCCTCCACGGCTATCCAGTTCTCGCCTGACCTTGCGCCTGTATCAATGACGCCGTGATCAAGCAAGCGAGCCGGCAAAAGGCTGCCTGCCGCCGG
CGCTCGGCAGTGCCGGCACCTCGGCCGGTGCTGCCGGTAAATCACCCGTGCAGGCCACAGGTTGAGGCAGGCATGAGCAGCGCCCAGCGTCCGCGTGTTC
GTGCCTCGAGCCTTTTCTGCATTGTCGGATCACCCGTGCAGGCCACAGGTTGAGGCAGGCA