Description :
Non Conding Region
Location :
Scaffold_1:144727- 144775
Sequence
48 bases(100 bases per row)
CATACTAATTCTGAATCCGCACAAATTAACGGTCAACGGTGTAGCAAT