Description :
Non Conding Region
Location :
Scaffold_1:144566- 145319
Sequence
753 bases(100 bases per row)
CCTCGTTGCTGCTCACACGACGACGAATTGCGAACTGCTGTGTGCGCGAAAAAAAGAGAAAGATCTTGAACAGGTGCGCGAGAGTGAAGGTCGTTAGTTT
CAAGAGCTCTCATTGCTTTGTATTGGTTGAAAAAGGAGAAGTACAACAGGTACGTGATTGGATAATAGTAACCGATGGCACACGCGATTGGCTGATATAC
TGGCGTGTGCGGACGGGTCGCAACGACTTGCATGTTGCTCATATAACTAACTACCGAGAGCATGGAACGGATGGATGCACGCAACTCTTCGCCTCCTCTG
TGTGTGTGTGTGTGTTTCCGGAGGTCGTTATGCAGTGTAATGCCTGAAGCACGTACGTATCTGGCAGTGCGAGCTGCTCTCCACGTTAATGGCCACGTTG
TTAGAAAAAGAAACCTGTTAACAAGAGAGCAAGCGCATTCAGCACCTTGCATGCGATTTGCCAAGGCGCGTTGCGACATTCTTTTCGCACTTGTATCAAA
GACAAGAGCGCGCATGCGGACGTCATAAGAGTAAAGACGCGTTGCAGTGGCGCAGTTGCATGCGTGTTGAAAAGATACTGTACGCTCATGGCGTCGTACA
TCGTCAGCAAAGTGTCCATTGATATGGATGGTCATGAACATGCCCGCTATGAAAAAGCTCGATATACGCACGTTGAATAGATTTATTTGCAGTGTTTGTT
GCTGGTTTATTGTTTAATATCGCTACGTTAAGGCAGTGCTGCAAGTGTGCGTT