Description :
Non Conding Region
Location :
Scaffold_1:144507- 144768
Sequence
261 bases(100 bases per row)
GCTCTGCACGGCCTCCATACCTTGCCGGTCGGGAGGTTCCCGCGTCCACGACCGCGTCCACGTCCGCGACCTCGCCCTCCGTCCCCACGGCNNNNNNNNN
NNNNNNNNNNGAACGCGGTCTCCGCGAGGGACATCCGTGCGAGGCGGCTTGGTACTGGCTGCAGCGGGCTTGGGACCCGCGGTGTCTTCAGACGCGGGCC
GCCGCTTGGCTGCCTTCGGCACGAACTGCGAGATGAAGATCCGACAGCATGAGTTAGCAAT