Description :
Non Conding Region
Location :
Scaffold_1:144181- 145817
Sequence
1636 bases(100 bases per row)
GCGCCCAGCGAATCGCGGGACTCTATCGGCCGGCACATTCTCGTGCTCCTTGGGAGTCAATGGTGGTGGTTGTTTCCTGTTTTTCCTGTTCTGCTCTCTC
TTGTTTCGAGCACTTTGCGTTCTAGCGGGCTCGCGGCTCCCTATCGGCTTTTCTTCCGTGGACCTTTGCTTGCTGGAGCGAGAAGGATAAAACGGGTTGG
GGCTCCTGCCGACGGTCGTGCCGCGCGCCGATTGGACGAAAAGCAGGCCTCGACCGCTTTTGCGCGAATCGCAGCGAGAGAGTCAGCAAGATGGGCAGGG
ACTAGGGCCCGACCTGGGCGGTTTTGACTTGATTTTTGTAAGCGGAGACAGGTCCAACGCATAGAAACCGCAACAGCGCATGCACCTCTTCAGAGGCAGC
TGTGGATCTCGCCGAAGGCAATTTTGTCGACGATTTGGTTGCAATTGGCGCGCTGCAGGGCACGGCGTCGACCGGCCAATTCGTTCACCCTATCTGGATG
ATTATCGCCCGCGGCTGCAGTGCTTGCGAGCTCGGCATGGAAGGCATGGTCACTCATCCGTGCCCGGGGTCCCAGGCCGAGTCCAGAATAGCCCAACGCC
GTAAGCCGCCAACGCCATAAGCCTAACGCCGTAAGCCGCCAACGCCATAAGCCTAACGCCGTAAGCCTAACGCCGTTGGACCATGCTGCTGGCGTTTCAG
CGCTGTTATTAGTGCCGGCAATAGTGCTGGCATTAATGCTGGCAACTATTGTGGCTTTGTCGGTGCTGCCTCAACTTGCTACGTTACTTGGGCCCCCCAA
GCAGCACTGCTACTCCATGTAAAGATGCCAGATAGAGACTGCCGCCAGCCATAAGTTAACGCGCTCTGTGCCATTGCGCTAGGCGCTGTTCAGGCTTGCA
TGGACTGGATCCCGGGAAATGCACGCTTGCTACACTGGTAAACCGGCGATGACGACACGGTGCTGCCGTCTCGACGCGACGGATGTCGTTAGACGGCTGC
AGTCGCAATGAAAAGCAGACGTCGATTTATTAAAGCCGAAGCTTCTTTGGCAAGTTCGCCCGCCGGTATGCTCGCATCGCCGGCAGCAATACAGTCGGCA
GTGCTCCGACGGTGGTGGGGCGGAGCGAGCCGTGAATCACGGCCCGGGATGACACATAACTACCGCTCCAAAGACTTTTCAATGTTAAGACGAGCTTGCC
TGGTAGGTTTATGCGAACATGAGCTTTTCGCGGTAATTGTTGAAGTTGTACTGTAAAATTGTCGCGCATCTATGCGGTCGAAACACGCTGTCGCGTCGTC
CTGGAACAGACAATAATAGGCCCATTTCAATGTAATACACAAAATGTAAATGAAACAGTGCTTTACAAGCACCAAAAGATGCTGGCCCAAAAGCTACGCA
CCACTGGCCCAAAAGCGTTGGCATCTACGCCCCGCGCATCAAAGGCTTGCCCTGCATTTGCACAGCACTGCCAGCACGCCATCGGATTCGCTCTCCGCAA
AGACACGCGCCTGATGACTGGCCCAACGATTGCATCCATCTGAATCTAGTGTGGACACACAACCTCGTGTTAACACAGTGTGGTGCATCTTTTCCTCCTT
GAAGCAAACGTCGGAAGAACCATCGCCTTCATCTCA