Description :
Non Conding Region
Location :
Scaffold_1:144133- 144261
Sequence
128 bases(100 bases per row)
TACGTGGTAATGCTGTTGCTGTTGAAGACTCGAAGGTAGAGCCATCACACACTATTACGATAACTAACCACAGCAGCAACAACATCGATTCTCGGCTCTT
GCGTTACTTTGTCGTCACTGGACAGTTC