Description :
Non Conding Region
Location :
Scaffold_1:143837- 143891
Sequence
54 bases(100 bases per row)
AAACGATTCGAACGAGCCCAATAGACTCGAAATAACTTAAGTATCGTGTCCATT