Description :
Non Conding Region
Location :
scaffold_1:14377- 16367
Sequence
1990 bases(100 bases per row)
AGGTTGGCTGTTGCGGGCGGAAGATGTGAAGAAAATGTGCGGGGAGGCCGCACATCGAGGAGGAAGGGTTATTTGTGGAGTGACGTATGGCCTGGGGCGA
AGCTACCATGTTTCAAGGTGGCACCCAGAGCTTCATAAGCAAGGAAGATCGATGAAGAAATAACGCAGAAGCCGAGATGAATGAGATCATGTGATCTTGT
TAAAGGGTTACGGGATAGCTAAGCGCGATTTCCTAATTCCCGGTCGTTGGGCGACAAAATTTGGCGGCAAGACGCGGAAGGCGAGAACCAGGGTGATCTG
GAAGGTTGTCGCGGTACTGGTTACGCCACGGCTCCTCCAAGTCAATCGCGCGAAGAGCCTCGACCAAGGTCGAGGGTCGTGGGGAACATCCCAAGCCGGG
ATACCACACTCTTTTCTCGCCGAGCCGGGGAAAATGCAGGAAAAAGGGGTCAAGGAGCAGATCTAGATCGCAATGGCCGTCGATCATCCCGCGGAGAATG
TGTCGCAAGAACGATTTCCAGCGGGCGCCAAGACGAGATCGCCGCTGACCTCGCTCTTCCCAGAAGGCGGCCAAGAACGGATCTGAGTTTCGAAGTGCCG
AGCTTATGGGGAAGGCGTGGGCCGATTCCCACAGGGCCTGTCGATGTTCGTCCTCCAACTGCAAATACTTGGTCGAGATCGGCGTGAACCAACCCGTCAT
CTCGAACGACACTGGCGTCACGACGACGTTCAGATTCTCCCAAGGAGAAATCGCGTACAGGGCCAGGATCTGGAGCTCAGTGATCAGCCCTTCGGACCAC
CGATTGGGAGGAGGAGTCTGGTCACTTGGAGGAAATAACCAATTCTTCGGTTTGGCGAAATGATGGAAAAGCAAGTTGACGTCCATCTCCAGCACGCTGA
CGCGACCGACGTATCTAGCCGGCCACGGATCGACGTCAACCGCAGTACGGCGAACACGATTTTGATAGCCGGGAATCCACTCGTCGCGAGGAATGGTGGT
TGGCGCAAGCTGTGCCAACTGCCCGGGGTTGAGAAGTTGATTGCGATGAGATCGTGGTTCGCTGATCACGCTGTCATCACTGTCAGTCTGGTTGACCACA
CCCGAAACCCCTTGAGCTGCGTCACGATCGGTTGCCGCCCCAGAGGTATGAGCAGTTTGATCACCATCACCGTCCTGGCTGTTGTTGTCACTCGACTGGT
CGCTGCGCTCACTGTTGTCACCGTGGCTGGATCGATGATCATCGTCACTGCTATCCCTGGGACTGTCACCACCACCGGCATCTCCAGAGCGATCATGGTT
CCCGTTCGAAGCCTCAGAGGAGTCGGGCGACCCGACATCAATTGGGCGATTGGGCGATCCACCAGTGGATGTGTCGGCAGAGCGGCGCCGGAGGGAAGAT
CGAGAACCAGTAAGCGCTGCCCTCAGTGAATCGTCATCACTTTTCGATGACGAACCGGATTGAGATCGACCATCCCCGTTTGAATGGGACGGACTGTCGC
CGCTAACATGCCCCGAGCTGGACCCTGAAGGCGAACGCCCACGGGGCGAATTGGAGCCCAACGAACGCGATCGACGAGGAGGAGGAGGAGGAGATGGACT
GGCCGAAGATCGTGGACTACGGGGCCTTTTGGAACTGCCTTGAGCGTCGGGCGAGCTCGGCGCTGGTGCCGAAGTGGACCCGGGCTGCACCAGGGAGATC
AATCCAGCCACACGATCACGGATGGTGTCGCGATCATGGCGGTAGACTCGGCCAACAATGTAGGCAGTACCGATAGGCCGATAGACCTTCGCTTTCATCC
ATCGTTCCTTGTCCGGCGAGAACGCGACCAGCTTGCTCACGTACACGTCCTGCAGCATGATGGGTGGTGTTCGTGTTGGCGTCGTTGTAGCACCCGTTAC
TCCACTGGTTGTTGCTCGCCCAGACTGTGGTGATTCGGGGATCGCGACTCCATCAGTTGGAATTCGGTCGCCGCGGCTAGCAGCAGCGCT