Description :
Non Conding Region
Location :
Scaffold_1:143752- 143848
Sequence
96 bases(100 bases per row)
ACGAAGGACAAGGTAGATATGCATGTACTTGTTCAAATTCAACAGGTTTGTTTGATGCATACGCTGAAGTGTAGTTCGTCATCTTTCTGATCTTGC