Description :
Non Conding Region
Location :
Scaffold_1:143731- 146370
Sequence
2639 bases(100 bases per row)
TTCCCAGAATGGTGTTCAGTAAAAATATTATTTTTGAAAATATAACATAAAATTATGAAGGCAACAACACTACGAGAAGGATCAACTTTTGGATCAAACT
TGACCTACGATTTATATAATATACAAGGAATTAGCTAAATTCGTCGCTTAAAATGTTGATCCAAAAGTTGGCCTGTCCCGCGGTTGATCCAAAAAAAAAT
CTCCAGTTGTTTATCAACTATCTTTATGCGACTGTGGTTAGCTAGAGAGTCCACTATCGCACGCCTACAATGTTGTGCTTAACATATCAGTTAGAGAGTG
CATCTGCCATTGAGCTACCGCATGATCATCTGGATTGAGCGACTTGCATTGATGGCGCTCGACCTACTCGATTGCCATTGTTCAGCTCCCTTTGTCTTAC
AGCTTCCTACCGTACGCTACATGTATGTTGTGCTGTTTCACGCAAGCGCGTTTTCAGTACACCACTACATATACCACACGCTCCCTGTTGAGCCTGTCAA
GCGTCTCAGCGGAGCTAGGATGCAGCAGTAATGTTATATGTCGAAAATGTCAAAGTGTGTGGGTTTTGTGGTTGTACTGATCTGATTGCATCATTTAATC
TGATTATTATATTTCATTTGAAGCTAATTTTTTCTTGCATTACAGTTTAGATACCGTAAATCACGATGGACATGTAACATGGAGTACCGTACTCCTTCGA
GCCTAAGTAGTCGCTGATACGAGAAAAAAGAGATCACATGAAGATCGACATGTGGCATGCATCATGCATACAGTTTGTAAACTTTTTATGATTGGTCAGA
AGTTTAGCTGTTAAATAGGAACGGGCCATCTGTTCTACATAAAATCCACATTCTCTTGCTACTTTGGCTGCAAAGGAAAACACGACATCCATATTTTTGT
AAGTGGCTAAAACTTTATATGTGCACTTGGAGGATGGAAGTTGTTGGTGGAGGGGGTCCACTTTAGATGATTTGGTCGTAACGGATGGTTTCGCTGGATT
TGTTGGCTACTGAGGACCTGAAAATTACGGTACTGCACGCTACATGATCGTCGTGATTTACGGCACCCCGTGTACTTCGCGCTTCCGCCTCTGTAAGAAT
CAGGAGGCCTTAGGTTTCTTTCTGCGGGCTCTTCTCGGACAACAGTGCCCGCAGCAGCTGGACTTCCTTCGGCTAGATTGATGAGGCATGCCTTGGTGAA
ACTCAAGACGGAGCGCCCCGGTGAGGACCACGGGAACCTTTGTGATGATGCCTACACGAAGCACGCCGTCCCAGCAGTGGGAAAACATCTCCTGTACATG
GACAAGAAGTTCAAGTGCGGCCCCGATAACCGTACAAGGCGCATCGTCTGGTCTCAGAAACCAGCCCTGATCATCATTGATCGTCGCCCGGGTCAGCAGA
GGGTACCTGACACTGCATTGCGCTTAGACAACGTAGCTACCAAGCCTTTATTCATAGAGTCCGACAACTACATGTACTTTGCTAACAACGAGCGTGAGCT
TAGCTCGTATTTTGAGCGGTCTACCCTACTGAGTATATTCCTCGTGCGAATGCAAAGAAAATGAAGAAGTAAGTGTCTCTTAAATTAGCAGAATGACTTT
TCGTTAGTGTTATTTTGATCCGTTTTGTTTCCATAATGTCTTGGGGTTTTGTATTTTGATTGATATACCTATGAAAACTTATAAAGTACAGATGCGCTTG
CATGAAAGGGATATATACTGTGCAGTTGGTCATGCATGCTCTTTGAAAATGAAGTCGATTTTTGTTACTTTAGGTTAGTTTCATTTCATTTTGAGTGACT
AGGGGTCTTGTTTATGAAAAAATGGATTTATGTTCAGTATACGTATGTATCGAGCAGATGTCAGAAAATACAGCAGCAGCCGCGGCAGCTTTGTGGCGAG
CGAGTTCAAGTTGACGCTGAATCTGGCGAGGCATAATACCGAAATTCACGCGCGCAACAACCGAAGTAGCTCGATCCATGGCAACCCGATGAGCACATTC
TATGCGCAAGGCTGGAGCAAGAAGGAAAACGAGCGTGGGAAGGCAGCGAAGCGGCGCAATTTTGCAAGTAGCAAGATTAGAACCCCAGCTCAAGACAACT
GCGTGCGCCAAGGAGTAGAGCTGCGCACAGGACATAAAGACGGTGCCAAGATTAGACAAGACCTGAAGACGTTCAAGATCACATATGAAGGCCTAGCCAA
GTATGAACGGATGAGTGTTACGTATTATAGCAGTAGACCAGCTAGAGGAGTCACGTGTATGGCTGCAGCAATATTGGCATGGGAAGAAGCTAGCCTTTTT
CGTTTCTCTCCGCCAGCCCCAAGCACTCTTCCTCCCTCTCCGATCTTCTCTGAAATAATTTTTTACGTCGTTGTCTGTATTCCGCATTTAGCTTCTATAA
TTGGTCGATAATATAATTTCCATGACATGAGGGACTCCTGATCTCGGAGGGAGGAACAGGTAGCATGGCTCACCGGTAAAACGAGCCTACTACTTAGAAC
GATACAAATTTAGAAATGATGTTCCAAAATTTTTATTCATTCCTGATTATGGCTACAACGAGGCCACCTAGATAGTGACTTATGCTGGCCTTAGGAGGGA
AGAACCAGGAGCGCCACATATACTCGTCCAGATAGGAGT