Description :
Non Conding Region
Location :
Scaffold_1:143355- 144383
Sequence
1028 bases(100 bases per row)
AATGGTGATACAAGACGCCAACCAACAAAACCCAAGTATCTTGATTGTGTAGTACGTAGAAGTAGATGTAGCGTGGTTTAGAAAGTAGATTGGCGATTCG
CGTAGCTTTGTAGGTTAGTTTGTAGAGAGCCAAGGAAGGCAGAAGAAGAAGCGTCAATAGAAAGTAGTAGATGAGATTGAAGGTTAGAAAATATTGTTAG
TGATTAAAGAAAGTTCTTCTTCCTGTCAAAACAGTCGTCTCAAGTCTAGAAAACTCCACCAGATAGGCAGTGTCGAGAAACACAAGCGTTCGTTTACTTA
CTCACTTGTTCCGATACGTCGATCAGCTTGTCGACATCGCACTCGAGAAATGCAACACCTCCATGCTTATCTGCAAACAGTCAATCTGCATTACCAGTGA
CGAAACCGGTGATACACGCGACCTCGATCTCGTACTCGAGCGCATCAGCAAGTCTTTCTGCACGTGGTACACGCCAGACCTGAATGTCATCAGTGCGGGG
TCAACTAAAGAGCGCATCGACCTGTGTGAAGGCGTGCTCTACCGCAAGTGCGCGCTGCCTGGTGCTCCAAGTGGAGTGGAAGTGATGTGTTTCAGCAGCC
GAATGATGGCGATCGCGTGCAACTTGCCTCTCAATTTCAACATCGAGATCCGGAAGCAGCAAATCCTGCAACACGTTGGAGTCCCTTACGACCCAATCGA
AGAGGCATGGCTTGCTGCAATGCGCGATAGCAAGTAGCTAGCTAGTCAGATACTGTAGCGCGCACAGATAATGTGAAGTCTCCGTTACATTATGTGAAGA
AGACAACTCTCAAATGGACGTTCCGTTTGGGCAGTTGAAGAGCAGGATTCAGATCCATCGGTCACTCACTCACCTGAACCGATGCTCAAGTCCAAAAATA
CGAGCTCAGGGTTCTGATCGCTCGTTCTGTTGGCGACGGCCCCAGCAGACCACAAAAGTGCTTTTTCTTCTTCTAACTGTGAAGGTCAAGCGGCTTGACA
GTCGACAACCTCGCGACGCGGACACTGA