Description :
Non Conding Region
Location :
contig_1:14327- 14649
Sequence
322 bases(100 bases per row)
AGGTTGGCTGTTGCGGGCGGAAGATGTGAAGAAAGATGTGCGGGGAGGCCGCACATCGAGGAGGAAGGGTTATTTGTGGAGTGACGTATGGCCTGGGGCG
AAGCTACCATGTTTCAAGGTGGCACCCGGAGCTTCATAAGCAAGGAAGATCGATGAAGAAATAACGCAGAAGCCGAGATGAATGAGATCATGTGATCTTG
TTAAAGGGTTACGGGATAGCTAAGCGCGATTTCCTAATTCCCGGTCGTTGGACGACAAAATTTGGCGGCAAGACGCGGAAGGCGAGAACCAGGGTGGTCG
GAAAGGTTGTCGCGGTACTGGT