Description :
Non Conding Region
Location :
Scaffold_1:143148- 143182
Sequence
34 bases(100 bases per row)
CTCCCCCGCACAGGTGTCCTCGATTCAGCCCCAA