Description :
Non Conding Region
Location :
contig_1:14295- 16271
Sequence
1976 bases(100 bases per row)
AGGTTGGCTGTTGCGGGCGGAAGATGTGAAGAAAATGTGCGGGGAGGCCGCACATCGAGGAGGAAGGGTTATTTGTGGAGTGACGTATGGCCTGGGGCGA
AGCTACCATGTTTCAAGGTGGCACCCAGAGCTTCATAAGCAAGGAAGATCGATGAAGAAATAACGCAGAAGCCGAGATGAATGAGATCATGTGATCTTGT
TAAAGGGTTACGGGATAGCTAAGCGCGATTTCCTAATTCCCGGTCGTTGGGCGACAAAATTTGGCGGCAAGACGCGGAAGGCGAGAACCAGGGTGATCTG
GAAGGTTGTCGCGGTACTGGTTACGCCACGGCTCCTCCAAGTCAATCGCGCGAAGAGCCGACCAAGGTCGAGGGTCGTGGGGAACATCCCAAGCCGGGAT
ACCACACTCTTTTCTCGCCGAGCCGGGGAAAATGCAGGAAAAAGGGGTCAGGAGCAGATCTAGATCGCAATGGCCGTCGATCATCCCGCGGAGAACGTGT
CGCAAGAACGATTTCCAGCGGGCACCAAGACGAGATCGCCGCTGACGTCGCTCTTCCCAGAAGGCGGCCAAGAACGGATCCGAGTTTCGAAGTGCAGAAC
TTATGGGGAAGGCGTGGGCCGATTCCCACAGGGCCTGCCGATGTTCGTCCTCCAACTGCAAATACTTGGTCGAGATCGTCGTGAACCAACCCGTCATCTC
GAACGACACTGGCGTCACGACGACGTTCAGATTCTCCCAAGGAGAAATCGCGTACAGGGCCAGGATCTGGAGCTCAGTGATCAGCCCTTCGGACCACCGA
TTGGGAGGAGGAGTCTGGTCACTTGGAGGAAATAACCAATTCTTCGGTTTGGCGAAATGATGGAAAAGCAAGTTGACGTCCATCTCCAGCACGCTGACGC
GACCGACGTATCTAGCCGGCCACGGATCGACGTCAACCGCAGTACGGCGAACACGATTTTGATAGCCGGGAATCCACTCGTCGCGAGGAATGGTGGTTGG
CGCAAGCTGTGCCAACTGCCCGGGGTTGAGAAGTTGATTGCGATGAGATCGTGGTCGCTGATCACGCTGTCATCACTGTCAGGCTGGTTGCCCCCGAAAC
CCCTTGAACTGCGTCACGATCGGTTGCCGCCCCAGGGGTATGAGCAGTTTGATCACCATCGCCGTCCTGGCTGTTGTTGTCACTCGACCGATCGCTGCGC
TCACTGCTGTCGCCGTGGCTGGATTGATGATCATCGTCACTGCTATCCCGGGGCTGTCACCACCACCGGCATCTCCAGATCGACCATGGTCCCGTTCGAA
GCCTCAGAGGAGTCGGACGACCCGACATCGATTGGGCGATTGGGCGATCCACCAGTGGATGTGTCGGCAGAGCGACGCCGGAGGGAAGATCGAGAACCAG
TAAGCGCTGCCCGCAGTGAATCGTCATCACTTTCCGATGACGAACCGGACTGAGATCGACCATCCCCGTTTGAATGGGACGGACTGTCGCCGCTAACATG
CCCAGAGCTGGACCCTGAAGGCGAACGTCCACGGGGCGAGTTGGAGCCCAACGAACGCGATCGACGACGACGAGGAGGAGATGGACTGGCCGAAGATCGT
GGACTACGGGGCCTTTTGGAACTGCCTTGAGCGTCGGGCGAGCTCGGCGCTGGTGCCGAAGTGGACCGGGCTGCACCAGGGAGATCAATCCAGCCACACG
ATCACGGATGGTGTCGCGATCATGGCGGTAGACTCGGCCAACAATGTAGGCAGTACCGATAGGCCGATAGACCTTCGCTTTCATCCATCGTTCCTTGTCC
GGCGAGAACGCGACCAGCTTGCTCACGTACACGTCCTGCAGCATGATGGGTGGTGTTCGTGTTGGCGTCGTTGTAGCACCCGTTACTCCACTGGTTGTTG
CTCGCCCAGACTGTGGTGATTCGGGGATCGCGACTCCATCAGTTGGAATTCGGTCGCCGCGGCTAGCAGCAGCGCT