Description :
Non Conding Region
Location :
Scaffold_1:142920- 145411
Sequence
2491 bases(100 bases per row)
GGAGCCATGAAAACGGTGAAGATACGACATATGGATATTCCAGAGCACTTGAACAGCCTTGTGCGCATGGTCATCAAATCTTGTCGCAAAAGCCGTGCTC
GAGCTGTGACTTCACGGGTTGAGCACTCAATCAGCTTCGTGTGCATACGTACCAAATGCTCCCACGACAACGTTCGCGAGTTGTGACTGTCACGGCTTGC
GAGGTTGGCAGTACACTTTGGCGTGCTTCACACCTGAGGTTGACAAGAAAGGTAATGGCATTGATGCCGAGTAAAACATGGGTGTGTGGTCATGGGCACG
CGAAGGAAAGATATCGGTGAGCCTTTGACGAGCAGCACCAAAGTTTGAGCTGCAACATTGCTGACTACTCTCGCACGTGAAGGTGCCGTCCATTATTTTG
CGTGAGTTAACGATCAACTATCGGGACACTACCGCGGTCGAACACAAGCCGTACGTTGCTTCTCGATCACTACGGCTGGATCACGTTTTTGATCGATGAC
AGGCTGAGGTTGGGCGTTGTTTCTATTCCTTGAGCCATCGTTGTTGGCTTTCGCTCGTATCAAACTGCCGAAAGACGCGTTATGAGTTGTGGGGTATCAG
CAGGAGAGCAGACTGTCTCGTGGCGTAAGAAAATAAATTATCTGTCATCGGAAGCACTGCTGTAGCAGGTTGAAGCACTGACAAAGTACAAGAGATACTG
TAGGAATTTTTGGCCTTCCTTCCGTGACACATTGGGTCAACGGCACGATAAGCTTACAGCCGACAGCCGTCCCGCTATCCAAGCAAATTGATTGTGCATT
GTCATAAAAGCTAATCCTGATGCACGCACACGTATTCGTGTCAACGGGTTTGCTTGTTAAAGCTCAAGCTCTCTTGATGCTATCATCTATTCGATGCTTG
CCCAAGCGAAGACAACCACCAATCTTGTTGGCTGCACATTCGATTGTTGCTATGGAAGTGGAGTGTTTCGACGCATTGGTGACCCTCGTGTTCGTGGGTA
TTCGCTACAAGGCTCTTTTTTTATCTACTGCTAGCATTTGCTTGCACATACCGTGCTCTATCACCGCACGATTTCCTGGTCAGTTCAAGACATCGGTTTC
CGCCAGAAGACTGACCAAACGCCGAATGTTACGGGATCATTTCGAGTATGCCGGGTGGTATTATTGCCACCCGAACATGGCATAGTCGCAATCGTCGCTG
TCGGCTTAGAAGTACATAGAGGCAAGATGCTGATGCTGCGCAGTCCGTACAAGACCAGAGAGTTTGGCGCAGAAATGTGCTGACGTCACTGTAGCAAAGA
CGCGAGCCGAAAGTGGCCATCTAGAACCATGTGCGGGTGGTTTTCTGCTGCTGTTGAGATGATCCTACATAGTTGAGGGAAGTGCCGTGACGGCGGCACT
CAGCTCTTGTTCTTCAAGCTCTCGATCGAGTCGTATGGCTGCTGCTCATGGTGCGTCAACAGGTAAATGTTGAGACCGCAATAGTCAGTATAACTTGCGA
AAGGAAGTCAATGGAGTGCGCCTCGAAGTCGACCACTGCGTCAAGGAAGTCGCATTGGTATTTTGACTCGTGCAGCTTTTACGCGCTTGATGGCAGCAAT
AATTTTGCTGATTCTCATCGCCTTACACTAATGGAAACAACTTGCGTAAGATCTTGTCCTTGTGACCACGAGATGCTGTACCCGTCAGCAACTCGTTTAC
GAACTTCCTCCACTGTGTCTTGACTTTTGCCCTACCAGTGCTAAAGGATGAGCGTTACGCTACGTGGAATCCTGATGAGTGGGTGATGTTTGATTCGCAA
CCTTTCAACCGGTGCAATCTGCTCATGAAGCGAGCGAGATCTATGTTGTAGCTAACGAAACTTTGTTCAAGGACGCTGTCATTCTGGCAGTCTCATCACA
TTTGTGGTACTGTTGGTGTGAACACTGCTTGACCATTGCAGATTCGACAATCATTGCAGCATGTGGCGTGACACGCCGAATACTCACGTGATCAGCACTT
ATCAATGAAACGATCGTATTGATCTCGTTGCTCGAGTTTCTCTTCTGACCTAGCTTCAGCTGCGGACCAACACTTAAGCACTCTTCTGGACATTAGGCAT
ACGGTAACAACTTCAACAGACCCGTCTATATTCTAAGGAATAGAATTGATTCAACTGCACTGCAAGATGAAAGAACCCACTCGGTGGTTTTGGTGCTCGT
AGCGCCAGCATGAAATGGTGACGAGATAGCTCTTGTGGTGCAAGGTGCTGTGAATTTGAGCTCTACCTTACCAAGTGCCATGCCAAGCATTAGAAAATAG
CTAAGATGACACTTGATAAGGCAGAGCGCAACTGTATTTTACGAATGACAGAGAGTGTCACTAAAGACAGTGTCAGTGCAGTAAATTTGCGGTAGCAGAT
ATCTCGTTTTTCGAATCGCGCAACTGTGACTTGTCGAGAGTATGCCTCCCGTTTATGCAAGTTGTCACTAATACGAACACATCTCCAATAA