Description :
Non Conding Region
Location :
Scaffold_1:142818- 143458
Sequence
640 bases(100 bases per row)
CAGCGGCGGTGTCTTCCATTTACCGGACGCGGACTGGAGAGCGGCGATCTGACCCGGAGCCGATGTGGTATCTGCGCATATCGCGCTTTGGCCAGTCGGG
GGTCGGCGTCGTGTCCTCGGTCGAGCCTCGGCCGGCGCGAGGCGGCCGGTGTACTTTCGCTCGCCTCGTCCTTTTTGCATGACCTGCTTCTCCATTCCCC
CTCGTTTTTTCCCCCCTCTCGCGGCCCGGCCGTCCAGCCGGCCACGATGCAGTTGAGCTATTTTAATCGAGAAACACGCTTCCTTCCTTGGTCATATTCA
TTCGCAATGTTTCGTGTTTGGTTTCGGTGTGAGGAGGTGTCATTGTCGTTGTCGTTGGAGGTTGGCGTTGACTTGACACGCGCCACGTGGGGCTGTCAGC
GAGAGTGGCACGCCACGTTCGACGCGGCGGAACACAACAGCCGCGGGCAGTTGTTCCGTTCCGTCGTGTCGCACGACGCGACCAACGCGCGGCCAGCCGG
GCGAAAGTTCAAGTTGTCACACTGCCTCGAAGCAGAGACTGTCACGTGCGGTGCCGCGCAACGACAAGGATGGCAGAGGATCAAAAGGTGGCAGAGGACT
GAGTGTGGGAGGACCAAATGTGAGAAAGACACGTGGATTT