Description :
Non Conding Region
Location :
scaffold_1:142665- 144266
Sequence
1601 bases(100 bases per row)
ACTCTCTCGATTTCTTCTTATACACCCGCTTTCTCTCTCCCTGTTCTTTGCTTAATATTGAGGGCAGCAGATGCTGCACTCTTCCAGTCGTAGAGTGGCA
AAATCTTTCGACAGGTGACAAGTAGACAGATGGGGGCGGACACTTAATGAGAGAAAGCAATGTGAAAACGGTGCGTTGCACACAGCGAGGAAGGAAATGT
GTGCTGCTACCAACCTGTCTCGACAACTGCAGCCACCTTCGTTACTGCGGTTTCGCGCTTGACAAGCAGATTGGGGAATGAGGATTATTCGGCAGAGAGT
CCTGTGCGGCTGGGGTTTCAGAGATTTCACACAAGTGTGGAGACCTGGCAGCTTGCTAGCGGAGACTTGGGGCAAGTCCCAAGTTGCCTTCTGCCAGCTG
GGAAAGCAACCATGTCTCGGTTTCCAGAGAGCGGTCGAGACAATGGATGGATGTGTGGCGGCGCTCGCTCCCGGGTAACCCACAAGAAAACCGATCTCAG
ACGTGTAGTATCGCATTGGACCGATCTGCTACGCACGGTGGACTGCGAGCTTGCAGGCTCTGAAGCCTTCAGAATTCAGGCGAGGGGTCATTTTGTCGAT
TTCGATTCAAAGAGAGATTTGAGGATAACCTCGATACTGAACACTGAAGTTCCCCCGAAGATGGCCGAAGAACTGCACAAAGTACTGCGATGGACCGGGG
CAGGAACCTGCCATAGGCGTCGACGCAGGAGTCGTGTCAGCAGTGGAGCACAGGAGCGGACCTGAGTACATATGAAATGCAACCTTGATGGAGCGAGCAC
ATTTTCGACTCTTTTTCCTTTAGACTTGATAGCGCTTCACCTGAGTAAACGTGAAGAGCAGTGCCTAACTGGGCATACCAGCAGCGTCCAGCACACGAAA
TAGTTCGACCAGTGTTATTCCCCAGACGTGCTTCGACTAGTTCTGCTCACCTTTTCAGTACCCCAGAGGCTGTACTTGTCGTAGTTTGACCCGCTGCTTG
ACATCAGTGAGGAATTGTCACTACGATATTCCTTGGCAGTCACATTCACTAAACACCGCTTGCAGCAGGGACTTTCTCTTCTCGAAAGTAGTTTCCGTAT
GGCACGATGCAGATGTCGCTGCCCTGGTAACGCAACTACAGGTGCGAGAGCGACACGATAGCCGACCTGATTTACGCAGGTCGGACAGACGCTCATAGCC
AATCAGAACCTATCAAAACAACCTGGCAAGAAACAATGGTTTCAACCTCGGTGGCCACTACGGTTGGTGCCACTGATAACGGTGAGGCAGTGCTGCATAC
TAGGAAACCATTTTCTAGAGCAATTTCAAGTTGAAGCGACACTTTGAGAGCTTCTGATTGGTTAACGATTTTGTAGAACAATTTTACATCACATCTTCGT
ATAAACGGTGTACCACACAAATAAACAGTGTACCACACAAGATATACGGACTCTGAAGAGTCGCGAAGGACGTTGGCCAACGATCTTCTGTCTCCACTGG
TCGAGTTGAGAGCTGAGAGACACCTGACCTTGCAGCACCTGACCTTGCAGCACCAGACACCTGACCCTGCAGCAACAGCAACGAACACCATCGCCTGTCC
A